Giuseppe Armani Review Book Volume 1 Number 4

• Periodical List
• HHS Writer Manuscripts
• PMC5890338

Int J Cardiol. Author manuscript; available in PMC 2018 Apr 9.

Published in final edited form equally:

PMCID: PMC5890338

NIHMSID: NIHMS949807

Essential office of ICAM-1 in aldosterone–induced atherosclerosis

Vincenzo Marzolla,¹ Andrea Armani,^{ane, *} Caterina Mammi,^{1, *} Mary Eastward. Moss,² Vittoria Pagliarini,³ Laura Pontecorvo,⁴ Antonella Antelmi,⁵ Andrea Fabbri,⁶ Giuseppe Rosano,^{7, viii} Iris Z. Jaffe,² and Massimiliano Caprio^{1, 9}

Vincenzo Marzolla

^oneLaboratory of Cardiovascular Endocrinology, IRCCS San Raffaele Pisana, Rome, Italian republic

Andrea Armani

ⁱLaboratory of Cardiovascular Endocrinology, IRCCS San Raffaele Pisana, Rome, Italia

Caterina Mammi

¹Laboratory of Cardiovascular Endocrinology, IRCCS San Raffaele Pisana, Rome, Italian republic

Mary E. Moss

²Molecular Cardiology Research Plant, Tufts Medical Center, Boston, Massachusetts, USA

Vittoria Pagliarini

^threeDepartment of Biomedicine and Prevention, University of Rome Tor Vergata, 00133 Rome, Italy Laboratory of Neuroembryology, Fondazione Santa Lucia, 00143 Rome, Italia

Laura Pontecorvo

^fourLaboratory of Pathophysiology of Cachexia and Metabolism of Skeletal Muscle, IRCCS San Raffaele Pisana, Rome, Italia

Antonella Antelmi

⁵Interinstitutional Multidisciplinary Biobank (BioBIM), IRCCS San Raffaele Pisana, Via di Val Cannuta 247, 00166 Rome, Italy

Andrea Fabbri

^sixDepartment of Systems Medicine, Endocrinology Unit, S. Eugenio & CTO A. Alesini Hospitals-ASL RM2, University Tor Vergata, Rome, Italian republic

Giuseppe Rosano

⁷Cardiovascular & Jail cell Science Institute, St George's Hospital NHS Trust, University of London, London, United Kingdom

⁸Department of Medical Sciences, IRCCS San Raffaele, Rome, Italy

Iris Z. Jaffe

²Molecular Cardiology Inquiry Found, Tufts Medical Centre, Boston, Massachusetts, Usa

Massimiliano Caprio

¹Laboratory of Cardiovascular Endocrinology, IRCCS San Raffaele Pisana, Rome, Italy

⁹Section of Human Sciences and Promotion of the Quality of Life, San Raffaele Roma Open Academy, Rome, Italian republic

Supplementary Materials

1: Supplemental Fig. 1. Aortic apoptosis regulatory proteins are non altered by ALDO infusion or ICAM-1 gene expression Aortic root was harvested from Aldosterone (ALDO)- or vehicle-infused ApoE−/−/ICAM-1+/+ or ApoE−/−/ICAM-1−/− mice fed an atherogenic diet for 4 weeks (North=6 mice per genotype and treatment). Western blot was performed to detect PARP or BCL-X expression in aortic root protein lysates. A) Representative immunoblot for PARP and BCL-X. β-actin was used as loading control. B–D) Densitometric scanning analyses for PARP-brusque (cleaved)/PARP-long (full length) ratio (B), BCLX-long (C) and BCLX-short (D) performed by Mac Os 10 (NIH Image ane.62 software). Values are expressed every bit means ± SEM.

GUID: 23C60D44-A4DA-4DC2-A1F6-A632B4E51C8F

ii: Supplemental Fig. 2. Neither ALDO infusion nor deletion of ICAM-1 factor alters aortic TGF-β1 transcript levels ApoE−/−/ICAM-1+/+ or ApoE−/−/ICAM-1−/− mice were treated with Aldosterone (ALDO) or vehicle and were fed an atherogenic nutrition for four weeks. The aortic root was harvested (N=6 mice per genotype and handling) and TGF-β1 mRNA was quantified by RT-PCR. Values are expressed as means ± SEM.

GUID: 02B3BA53-2073-4305-9109-5D77FBDE295E

Abstruse

Objective

Elevated aldosterone is associated with increased gamble of atherosclerosis complications, whereas treatment with mineralocorticoid receptor (MR) antagonists decreases the rate of cardiovascular events. Here we examination the hypothesis that aldosterone promotes early atherosclerosis by modulating intercellular adhesion molecule-i (ICAM-ane) expression and investigate the molecular mechanisms by which aldosterone regulates ICAM-1 expression.

Methods and Results

Apolipoprotein-E (ApoE)^−/− mice fed an atherogenic diet and treated with aldosterone for 4 weeks showed increased vascular expression of ICAM-1, paralleled past enhanced atherosclerotic plaque size in the aortic root. Moreover, aldosterone handling resulted in increased plaque lipid and inflammatory jail cell content, consistent with an unstable plaque phenotype. ApoE/ICAM-1 double knockout (ApoE^−/−/ICAM-one^−/−) littermates were protected from the aldosterone-induced increment in plaque size, lipid content and macrophage infiltration. Since aldosterone is known to regulate ICAM-ane transcription via MR in human endothelial cells, nosotros explored MR regulation of the ICAM-1 promoter. Luciferase reporter assays performed in HUVECs using deletion constructs of the human ICAM-1 factor promoter showed that a region containing a predicted MR-responsive element (MRE) is required for MR-dependent transcriptional regulation of ICAM-one.

Conclusions

Pro-atherogenic effects of aldosterone are mediated by increased ICAM-1 expression, through transcriptional regulation by endothelial MR. These data heighten our understanding of the molecular mechanism by which MR activation promotes atherosclerosis complications.

Keywords: Intercellular Adhesion Molecule-1, Aldosterone, Mineralocorticoid Receptor, Atherosclerosis

1. Introduction

Higher aldosterone (ALDO) levels are associated with increased risk of cardiovascular ischemic events and bloodshed [one–3]. For example, patients with primary hyperaldosteronism have a four or six fold increased incidence of stroke or myocardial infarction (MI), respectively, compared to patients with essential hypertension[4]. Fifty-fifty within the normal range, ALDO levels to a higher place the median predict a significantly increased risk of MI, stroke and decease in patients with known coronary artery disease [2]. ALDO is as well a significant independent predictor of progression of atherosclerosis in humans[v]. ALDO levels are increased in the growing populations with obesity, middle failure, and resistant hypertension [6–9] thus understanding the machinery by which ALDO promotes cardiovascular ischemia has important clinical implications. ALDO acts by binding and activating the mineralocorticoid receptor (MR), a hormone activated transcription gene. Accordingly, randomized clinical trials reveal that treatment with MR antagonists (spironolactone or eplerenone) reduce cardiovascular events and better survival in patients with heart failure [10,11].

Atherosclerosis is a chronic inflammatory disorder of the vasculature. In response to cardiovascular risk factors, the endothelium lining the vessel becomes damaged. This dysfunctional endothelium potentiates leukocyte adhesion and migration into the vessel wall [12,13]. Dysfunctional endothelial cells (EC) promote vascular inflammation past expressing surface adhesion molecules involved in the development of atherosclerotic plaques including intercellular adhesion molecule-1 (ICAM-1), vascular prison cell adhesion molecule-1 (VCAM-1) and endothelial cell selectin [fourteen,15]. Intravascular leukocytes then have up lipids and course the core of the atherosclerotic plaque. Plaques with increased inflammatory cell infiltrate and lipid content are prone to rupture and thrombosis, and this vulnerable plaque phenotype is the cause of nigh MIs and strokes [16]. Thus, understanding mechanisms driving plaque progression and inflammation and the office of ALDO/MR, may explain the clinical observations linking ALDO to cardiovascular ischemia. Animal studies support a role for ALDO and MR in the development of atherosclerosis. ALDO infusion into the apolipoprotein E knockout mouse (ApoE^−/−), a model decumbent to atherosclerosis, induced an increase in plaque size with increased plaque lipid and inflammatory cell content, like to the vulnerable plaque in humans [17–nineteen]. Conversely, MR antagonism reduced plaque development in ApoE^−/−mice [20–22].

The machinery by which ALDO contributes to vascular inflammation and atherosclerosis is not clear. In a mouse model of diet-induced obesity, animals developed endothelial dysfunction by an ALDO-dependent mechanism, and this issue was prevented by MR antagonist treatment, implicating a part for the MR [23]. A office for MR in ECs is suggested by studies in mice with MR specifically deleted from ECs. These EC-MR knockout mice were protected from endothelial dysfunction induced by ALDO or Angiotensin II infusion or exposure to loftier fatty nutrition-induced obesity [24–26]. Nosotros previously demonstrated that ALDO treatment of man coronary artery ECs increases ICAM-1 gene expression and in turn promotes leukocyte adhesion to cultured human coronary ECs. These effects were abolished by MR antagonists or by MR knock downwardly in cultured ECs [27]. However, whether MR regulation of ICAM-1 expression contributes to vascular inflammation and atherosclerosis in vivo has never been investigated. ICAM-ane knockout mice showed reduced atherosclerosis development in the ApoE^−/− model indicating an important office for ICAM-one in the formation of atherosclerotic plaques [28]. In gild to investigate if the atherogenic effects of ALDO are mediated by ICAM-one, we analyzed size and composition of atherosclerotic plaques in the aortic root of ALDO-infused double knockout mice (ApoE^−/−/ICAM-1^−/−). Nosotros observed that genetic deletion of ICAM-1 prevented the increase in plaque size, lipid content and plaque inflammation induced by ALDO. In addition, in vitro studies indicated that the presence of a MR binding-site in the promoter region of ICAM-1 gene was necessary for MR-induced ICAM-regulation.

2. Materials and Methods

2.one. Mouse Atherosclerosis model and serum analysis

Animal procedures were approved past the Italian National Plant of Wellness intendance and apply committees. Mice scarce in both ApoE and ICAM1 gene were generated past mating ApoE^−/−mice with ICAM-1^−/−mice (C57BL/half-dozen groundwork).The resulting ApoE^−/−/ICAM-one^+/− mice were intercrossed to produce ApoE^−/−/ICAM-1^−/− mice and equivalent ApoE^−/−/ICAM-1-intact littermates. In nine-week-old male mice were placed osmotic minipump (Alzet model 1004) subcutaneously containing vehicle (ethanol/saline) or aldosterone (vi µg/mouse/day) for iv-week. Over the 5 days prior to animal euthanasia, tail-gage blood pressure and heart rate measurements were performed using the CODA mouse tail cuff System and software (Kent Scientific) by a iii-day training and measurement protocol that we have previously described and validated [29]. Prior to all surgical procedures, mice were anesthetized with ane.v% isofluorane. Animals undergoing survival surgeries received 0.05 mg/kg buprenorphine administered subcutaneously prior to incision, and additional doses at 8-hr intervals if deemed beneficial. At the fourth dimension of minipump implantation, mice were placed on a proatherogenic HF diet (Harlan Teklad TD.88137). At the time of sacrifice, peripheral blood samples were collected via retro-orbital haemorrhage. Fasting serum samples were assayed for glucose, cholesterol, sodium and potassium levels (Plaisant Srl Rome, Italia). ALDO serum was assayed (Siemens Health Care RIA) according to manufacturers' instructions.

2.ii. Immunohistochemistry

At the time of euthanization, animals were fasted for 4 hours, and blood was collected from the inferior vena cava. Animals were then perfused with phosphate-buffered saline (PBS), and tissues were collected. The aortic valve were embedded in optimal cut compound (October).

Cryosections of embedded aortic roots at the site where all three aortic valve leaflets could be visualized were taken at five-micron intervals. Sequential sections were stained with Oil-Red O (ORO), picrosirius red (PSR), anti-Mac3 antibiotic (BD Pharmingen) or anti-ICAM1 to quantify lipids, necrotic core, collagen content, activated inflammatory cells or ICAM1 expression in the aortic root at the level of the aortic valve. Total pixels staining positive for the component of involvement were normalized to overall plaque area to generate fold increase respect to vehicle-treated mice. Images were collected and analyzed by a treatment blinded investigator using ImagePro Premier software (Media Cybernetics). ImagePro Premier software was too used to measure the necrotic core of each plaque (measured as percentage of the total plaque area).

2.3. Plasmids construction

3 Kb of human ICAM-1 promoter (NCBI Reference Sequence: {"type":"entrez-nucleotide","attrs":{"text":"NG_012083.i","term_id":"237820700","term_text":"NG_012083.1"}}NG_012083.one) was cloned into pGL3 BASIC vector (Promega) upstream of luciferase gene. Moreover iv 5' deletion fragments of the 3Kb promoter (1500 bp, 1141 bp, - MRE and 872 bp) were generated employing appropriate restriction enzymes or PCR reaction and were cloned into pGL3 BASIC vector upstream of the firefly luciferase gene. The 1500 bp fragment was obtained by double digestion of 3 Kb promoter of ICAM-one with SacI and NarI and cloned into into pGL3 BASIC vector previously digested with the same enzymes.

The 1141 bp, -MRE and 872 bp fragments were generated by PCR reaction performed with Pfu Deoxyribonucleic acid Polymerase (Promega) employing equally template the 3 Kb ICAM-1 promoter and using the following couples of primers:

• F 1141 bp (GAAGAGCTCCCCGGGGAGGATTCCTGGGC) and

• R 1141 bp (AATGGCGCCGGGCCTTTCTTTATGTTTT);

• F - MRE (GAAGAGCTCAGGCGGCGCGGCTTGGTGCT) and

• R - MRE (AATGGCGCCGGGCCTTTCTTTATGTTTT)

• F 872 bp (GAAGAGCTCGGGTTTAATGCCGGTTTAC) and

• R 872 bp (AATGGCGCCGGGCCTTTCTTTATGTTTT)

The PCR product was digested with SacI and NarI and cloned into pGL3 BASIC vector cutting with the same enzymes. T4 DNA ligase (BioLabs) was used for cloning reactions.

2.4. Transfection of HUVEC and Luciferase Assay

Sixteen hours earlier transfection, viii × 10^four HUVECs were plated into vi-well cell culture plates with ii ml of complete EGM-two medium (Lonza). Ii hours earlier transfection, cells were shifted into medium EGM-2 medium containing 2% stripped serum and deprived of hydrocortisone and gentamicine. For the transfection, 98 µl of EBM-2 (basal medium) and three µl of FUGENE six were added and gently mixed inside a sterile tube and incubated for 5 minutes at room temperature. So, 1 µg total of appropriate mixture of vectors (containing 980 ng of 3kb ICAM-1 plasmid or equimolar concentration of plasmids containing promoter's deletions and 20 ng of pRL-TK vector) were added in the tube and incubated for ane hour at room temperature. The FUGENE 6/DNA complexes were then added to the cells in a drib-wise mode and cells returned to the incubator. The culture plates were incubated at 37°C and v% CO₂ for two days. Twenty four hours after first of transfection, cells were treated every bit indicated in the effigy 6 (aldo 10^−eight M, aldo 10⁻⁸ K + SPIRO ten⁻⁵ G, SPIRO 10⁻⁵ M). Twenty four hours postal service handling the cells were and then washed twice with PBS and lysed with 250 µl of i× Passive Lysis Buffer (Promega). The plates were rocked several time to ensure consummate coverage of the cells with lysis buffer. And so the cells were scraped and the lysate was transferred into a microcentrifuge tube, vortexed and centrifuged at 12,000 × yard for 2 minutes at 4°C. The supernatant was transferred into a new microcentrifuge tube.

For the Luciferase analysis, 100 µl of Luciferase Assay Reagent Ii for each sample were dispensed into a white Optiplate 96 (PerkinElmer) and 20 µl of lysed production were added. Immediately the plate was read in a luminometer (Tecan Infinite 200) programmed to perform a 12-second measurement read for Firefly Luciferase activeness. After this measurement, 100 µl of 1× Stop &Glo Reagent were added and the plate was briefly mixed. The plate was read over again with a 12-second measurement for Renilla Luciferase activeness (encoded bypRL-TK vector). The ratio of the Firefly: Renilla Luciferase activity represents the normalized reporter gene expression.

ii.five. Adenovirus Infection and prison cell culture written report

HUVECs were grown to 50% of confluence in complete EGM-2. Two hours earlier infection, cells were shifted into EBM-2 serum free. The cells were infected in triplicates with the control adenovirus which expresses the light-green fluorescent poly peptide (Ad-GFP), or the adenovirus expressing the ascendant negative-c-Jun form (Advertising-dn-c-Jun), or the adenovirus expressing the dominant negative-IκBα (Advertizing-dn- IκBα). Eight hours postal service-infection, cells were shifted into EGM-2 medium containing 2% stripped serum and deprived of hydrocortisone and gentamicine. The cells were treated for 24 hours with ALDO 10^−viii Grand, ALDO x^−viii Thousand + SPIRO 10⁻⁵ M and SPIRO 10⁻⁵ Thou. At the end of pharmacological treatment, the cells were washed twice with 1 × PBS and immediately lysed in 1 ml of TRIzol Reagent (Invitrogen) for RNA extraction. In other experiments, afterwards infection, the cells were transfected with 1141 bp ICAM-i promoter vector and underwent aldosterone and SPIRO treatment as above indicated. At the end of treatments the cells were washed twice with 1 × PBS and lysed with 250 µl of one× Passive Lysis Buffer (for luciferase assay).

In preliminary experiments, we examined GFP transgene expression in HUVECs infected with Ad-GFP at a MOI of fifty, 100 or 200 or 500 by using fluorescence microscopy and found that GFP expression reaches 95% following adenoviral infection at l MOI.

2.6. RNA analysis

Cells and vascular tissue were washed twice with 1 × phosphate-buffered saline (PBS), harvested, and immediately lysed in 1 ml of TRIzol Reagent (Invitrogen). Total RNA was extracted following manufacturer's indications. The purity, integrity, and yield of RNA were analyzed by Agilent Technologies 2001 bioanalyzer using the RNA 6000 LabChip kit. One microgram of full RNA was treated with RQ1 RNase-Free DNase I (Promega) and contrary-transcribed using GoScript Reverse Transcription Organisation (Promega). Quantitative PCR was performed in Mx3000P light cycler (Stratagene) using GoTaq qPCR Master Mix (Promega) every bit indicated by the manufacturer. All primers were optimized for existent-fourth dimension RT-PCR amplification checking the generation of a unmarried peak in a melting bend assay and the efficiency in standard curve amplification (>98% for each primer pair).Target gene expression was normalized to 18S mRNA expression, the relative alter in expression for each treatment was calculated by Mx3000P software version 2.0 (Stratagene) and is reported every bit arbitrary units. For all experiments each sample was analyzed in duplicate. Couples of primers used for real-time distension are:

• ICAM-1

  • F CAAGGCCTCAGTCAGTGTGA and

  • R CCTCTGGCTTCGTCAGAATC

• TGF-β1

  • F TGCGCTTGCAGAGATTAAAA and

  • R CGTCAAAAGACAGCCACTCA

2.vii. Flow cytometry assay

For flow cytometry at the end of each treatment the HUVECs were labeled with phycoerythrin-conjugated mouse antihuman ICAM1 monoclonal antibody or IgG1 isotype control. Mean fluorescence index was calculated by subtracting the isotype Ig control mean fluorescence from the ICAM1-stained mean fluorescence. Data are expressed as percentage of hateful fluorescence index of vehicle-treated cells at each treatment fourth dimension.

2.8. Western blot analysis

Specimens of aortic root (n=six per genotype and handling) were lysed in lysis buffer containing 1% Triton X-241 100, 50mM Hepes, 10% glycerol, 150mM NaCl, 1mM NaVO4 and 75 U of aprotinin. The lysates were subjected to polyacrylamide gel electrophoresis (SDS-Folio), and transferred onto PVDF membranes. Membrane were probed with anti-PARP (Cell Signaling), or BCL-Ten (BD Pharmingen) or β-actin (Sigma-Aldrich) antibodies and horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (Sigma-Aldrich, Milan, Italy). Immunoreactive bands were visualized using the ECL Western detection system (General Electric Healthcare, Milan, Italian republic). Densitometric scanning assay was performed by Mac OS 10 (Apple tree Computer International, Milan, Italy) using NIH 252 Image ane.62 software.

two.9. Statistical assay

Information are reported as the mean +/− standard fault of the mean. Data points greater or less than two standard deviations from the mean were considered statistical outliers and were excluded from all analyses. Statistical comparisons were made by t-test, one-way or two-mode ANOVA followed by Bonferroni post hoc analysis using Prism half dozen.0 (GraphPad). P<0.05 was considered significant.

iii. Results

iii.ane. ALDO infusion increases aortic ICAM-1 expression in an atherosclerosis model in vivo

In lodge to explore the role in vivo of ICAM-one in ALDO-induced atherosclerosis, we generated ApoE^−/−/ICAM-1^−/−double knockout mice. Male person ApoE^−/−/ICAM-ane^−/−mice and ApoE^−/−/ICAM-i^+/+ littermates were fed an atherogenic high fat diet (HFD) and randomized to infusion with vehicle or ALDO for 4 weeks. After 4 weeks, ICAM-ane mRNA expression was quantified in whole aortic tissue. ALDO infusion significantly increased ICAM-i mRNA expression in the aorta of ApoE^−/−/ICAM-1^+/+ mice compared to vehicle-treated ApoE^−/−/ICAM-one^+/+ mice (Fig.1A). As expected, ICAM-1 transcript levels were about undetectable in ApoE^−/−/ICAM-one^−/− mice regardless of ALDO- or vehicle-treatment, validating ICAM-one deletion in our mouse model. Consistent with the transcript contour, ICAM-i poly peptide expression was evident in atherosclerotic plaques in aortic root sections of vehicle- and ALDO-treated ApoE^−/−/ICAM-one^+/+ mice, every bit shown by immunostaining for ICAM-1 (Figure 1B). Equally expected ApoE^−/−/ICAM-1^−/− mice, did not show any ICAM-1 staining.

ALDO infusion in ApoE^−/− mice induces aortic ICAM-1 expression

Aldosterone (ALDO) or vehicle was infused into ApoE^−/−/ICAM-1^+/+ or ApoE^−/−/ICAM-one^−/− mice fed an atherogenic diet for iv weeks and the aorta was harvested. A) ICAM-one mRNA was quantified by RT-PCR in mRNA isolated from whole aorta. Values are expressed as means ± SEM. **=p<0.01 versus ApoE^−/−/ICAM-i^+/+ + vehicle; ***=p<0.001 versus ApoE^−/−/ICAM-1^+/+ + ALDO. B) Representative immunostaining (red staining, arrows) for ICAM-i in aortic root sections in vehicle- or ALDO-treated ApoE^−/− mice fed an atherogenic diet for 4 weeks. N=6 for each treatment and genotype for the whole effigy.

iii.2. ICAM-i is required for ALDO-enhanced atherosclerotic plaque formation

Every bit previously demonstrated [17], low dose of ALDO infusion (6 µg/mouse per day) significantly increased early atherosclerotic plaque formation in the aortic root of ApoE^−/− mice fed an atherogenic diet for 4 weeks (Figure 2).This dose of ALDO was chosen because it produces a 3- to v-fold elevation in serum ALDO levels, like to that seen in patients with cardiovascular risk factors [6–8]. This level of ALDO did non cause whatsoever significant change in blood pressure, body weight, or serum total cholesterol (Tabular array i). Importantly, littermates lacking ICAM-1 were protected from the ALDO-induced increase in plaque burden (Figure 2). These data support the concept that at levels that exercise not increase blood force per unit area, ALDO increases aortic ICAM-1 expression in high fat fed ApoE^−/− mice and that ICAM-1 is necessary for ALDO-induced atherosclerosis (Figure 2).

ICAM-i is required for early ALDO-induced atherosclerosis evolution

A, Aortic roots from Aldosterone (ALDO)- or vehicle-infused ApoE^−/−/ICAM-ane^+/+ or ApoE^−/−/ICAM-ane^−/− mice fed an atherogenic diet for 4 weeks were harvested. Sections were stained with Oil-ruby-red-O and plaque surface area, (B) pct of the plaque area that stains positive for lipids (C) and percentage of the plaque composed of necrotic core (D) were compared between genotypes and treatments. Values are expressed as means ± SEM. **=p<0.01, ***=p<0.001vs vs ApoE^−/−/ICAM-1^+/+ + vehicle; ##=p<0.01, ###=p<0.001 vs ApoE^−/−/ICAM-i^+/+ + ALDO. N=12 per genotype and treatment.

Table 1

Cardiovascular risk parameter evaluation in ApoE^−/−/ICAM-1^+/+ and ApoE^−/−/ICAM-1^−/−mice treated with vehicle or ALDO.

Genotype	ApoE−/−/ICAM-1+/+		ApoE−/−/ICAM-ane−/−
Treatment	Vehicle (north)	ALDO (n)	Vehicle (n)	ALDO (n)
Prerandomization
Weight, grand	26.3±0.6 (18)	24.7±0.five (20)	24.8±0.5 (16)	25.five±0.7 (17)
Afterwards iv weeks of infusion
Weight, g	28.6±0.7 (eighteen)	27.6±0.v (19)	28.9±0.half dozen (16)	27.v±0.7 (17)
Blood glucose, mg/dL	173±8 (viii)	185±7 (viii)	170±x (eight)	179±9 (viii)
Serum Cholesterol, mg/dL	572±xviii	535±20	564±25	538±28
Serum ALDO, nmol/L	1.28±0.3	4.07±0.seven**	1.32±0.four	four.19±0.3**
Serum Sodium, mEq/L	143.8±0.viii	148.2±1*	144.v±1.two	149.0±0.9*
Serum Potassium, mEq/L	3.98±0.2	three.01±0.one*	4.01±0.5	3.09±0.4*
Systolic BP, mm Hg	104±3.five (half-dozen)	111.0±2.7 (half dozen)	106±vi.8 (6)	112.nine±5.i (6)
Diastolic BP, mmHg	73±1.7 (6)	79.7±ane.3 (six)	73.9±vi.2 (6)	79.9±5.2 (vi)
Heart Rate, pulse/min	532.9±26.2 (6)	582.4±47.6 (6)	513.seven±52 (5)	579.8±35.6 (6)

3.iii. ICAM-one is necessary for ALDO induction of a vulnerable plaque phenotype

Plaque composition was adjacent investigated in histological sections of aortic root from ALDO- or vehicle-treated ApoE^−/−/ICAM-1^+/+ and ApoE^−/−/ICAM-ane^−/−littermates. The fraction of the plaque that is composed of lipids or necrotic core was quantified in Oil Reddish O stained sections (Effigy 2) and the inflammatory cell and collagen component was quantified in serial sections of aortic root stained with anti-Mac3 antibody or Sirius Crimson, respectively (Figure 3). As previously demonstrated, in mice with intact ICAM-one, ALDO treatment resulted in plaques with a meaning increment in lipid content (two.1 fold, Figure 2C). ALDO did non affect the percent necrotic core (Figure 2d) or markers of apoptosis (Supplemental Figure i). ALDO as well increased activated inflammatory jail cell-positive surface area (2.1 fold, Figure 3A) compared with vehicle-treated ApoE^−/−/ICAM-ane^+/+ mice. Plaque fibrosis as measured by collagen content did non differ amongst treatment groups (Figure 3B) nor did ALDO modify TGF-β1 transcript levels by real fourth dimension RT-PCR in samples of aortic root (Supplemental Figure 2). Overall ALDO produced a plaque phenotype with increased lipids and inflammation with no change in necrosis and fibrosis. Importantly, the ALDO-induced increase in plaque lipid content and inflammation was prevented in ApoE^−/−/ICAM-1^−/− mice (Figure2B and ​ 3A, respectively), indicating that ICAM-1 is necessary to mediate the effects of ALDO on plaque phenotype.

ICAM-ane is necessary for aldosterone to produce plaques with increased inflammation

Aldosterone (ALDO) or vehicle was infused into ApoE^−/−/ICAM-ane^+/+ or ApoE^−/−/ICAM-one^−/− mice fed an atherogenic diet for 4 weeks and the aortic root was harvested, and sectioning was performed. Mac3 immunostaining was used to label inflammatory cells and picrosirius red staining was used to quantify fibrosis. The percentage of the plaque area that stained positive for activated inflammatory cells (anti-Mac3 antibiotic, A) and collagen (Sirius Red, B) was compared betwixt genotypes and treatments. Information was expressed as fold increase compared with ApoE^−/−/ICAM-1^+/+ + vehicle. Values are represented equally means ± SEM. **=p<0.01 vs ApoE^−/−/ICAM-1^+/+ + vehicle; #=p<0.05 vs ApoE^−/−/ICAM-one^+/+ + ALDO. North=12 mice per genotype and treatment.

3.4. ALDO regulates ICAM-i expression in homo endothelial cells past MR-dependent transcriptional control

To explore the mechanism by which ALDO regulates endothelial ICAM-1expression, we starting time examined ALDO regulation of ICAM-1 mRNA expression in man umbilical vein ECs (HUVEC). Transcript levels of ICAM-i were analyzed by qRT-PCR in HUVECs treated with ALDO (10⁻⁸M) in presence or absenteeism of the MR antagonist spironolactone (SPIRO, 10^−fiveM), in serum defective steroid hormones. ALDO treatment of HUVECs for 24 hours resulted in a significant increase in ICAM-1 mRNA expression (ane.5 fold) and this was significantly inhibited by SPIRO (Figure 4A), supporting a MR-dependent mechanism. In addition to transcriptional regulation, ALDO is besides capable of exerting rapid non-genomic furnishings on vascular cells [30,31]. In club to explore potential non-genomic effects of ALDO on ICAM-1 surface poly peptide expression, HUVECs were treated with ALDO (ten^−eightThou) for 30 minutes, one hr, 3 hours, 24 hours in the presence or absenteeism of SPIRO (ten⁻⁵M) and surface ICAM-1 protein levels were quantified by flow cytometry. ALDO did not significantly increase ICAM-1 protein surface expression betwixt 30 minutes and iii hours making non-genomic furnishings on ICAM-i membrane trafficking an unlikely mechanism. In accordance with the qPCR studies, ALDO treatment significantly increased surface ICAM-1 poly peptide after 24 hours, (Figure 4B). This increase was prevented by co-handling with SPIRO. These information support a model in which ALDO regulates ICAM-1 expression in HUVECs through a genomic mechanisms that requires endothelial MR.

MR regulates ICAM-1 mRNA and poly peptide expression in human endothelial cells in a genomic time frame

A, Human umbilical vein endothelial cells (HUVEC) were treated with vehicle or aldosterone (ALDO ;ten^−eightM) or ALDO + spironolactone (SPIRO ; ten^−fiveOne thousand) for 24 hours and mRNA was quantified by qRT-PCR and expressed every bit fold-increase versus vehicle. ***=p<0.001 versus Vehicle; ###=p<0.001 versus ALDO. B, ICAM-1 surface poly peptide was measured by flow cytometry and expressed as percentage of vehicle-treated cells at each time point. Values are represented as ways ± SEM in the whole effigy. *=p<0.05 vs 24 hours of vehicle; #=p<0.05 vs 24 hours of ALDO.

3.5. Promoter analysis of human ICAM-1 factor in HUVECs

To farther investigate the transcriptional regulation of ICAM-1 past ALDO, luciferase reporter assays were performed in HUVECs afterward transient transfection with a reporter vector containing the 3kb proximal promoter region of the homo ICAM-1 gene. ALDO treatment (x^−eight1000) significantly increased the action of the 3kb ICAM-1 promoterfragment (Figure 5A) to a similar extent equally the ALDO-induced increased ICAM-one mRNA expression (Figure 4A). This issue on ICAM-ane promoter action was inhibited past the co-treatment with SPIRO (10^−fiveM) (Figure 5A), supporting a MR-dependent mechanism for ALDO regulation of ICAM-1 transcription.

MR regulates transcription of the human ICAM-1 promoter

A) Human umbilical vein endothelial cells (HUVEC) were transfected with a luciferase reporter containing the 3Kb promoter of human ICAM-1 cistron. Transfected HUVECs were treated with vehicle, aldosterone (ALDO 10⁻⁸M), ALDO + spironolactone (SPIRO; 10^−vThou) or SPIRO alone. Luciferase activity was expressed as fold increase compared to Vehicle. ***=p<0.001 versus vehicle and ###=p<0.001 versus ALDO. B) Schematic representation of ICAM-one promoter fragments. C) Transcriptional activity of a serial of 5' ICAM-1 deleted promoter fragments. HUVECs, transfected with different promoter fragments, were treated with vehicle, ALDO (10^−eightM), ALDO + SPIRO (10^−fiveM) and SPIRO. The luciferase activity was expressed every bit fold increment compared to Vehicle. **=p<0.01, ***=p<0.001 versus vehicle and #=p<0.05, ##=p<0.01 versus ALDO. Values are expressed as means ± SEM in the whole figure. N = 3 independent experiments.

Series v'-deletions of the ICAM-i promoter fragment were prepared to identify sequences critical for ALDO-regulation of ICAM-1 promoter activity. Figure 5B shows the deleted ICAM-i promoter fragments used in the transfection experiments. ALDO administration significantly increased the activeness of the 1500 bp and the 1141 bp ICAM-1 promoter fragments (i.8 and 2.2 fold, respectively), without affecting the activity of the 872 bp construct (Figure 5C).The ALDO-mediated increase was inhibited by co-treatment with SPIRO. Altogether these data identify putative sequences localized in the region of ICAM-1 promoter comprised between 1141 and 872 bp that are necessary for MR activation of the ICAM-ane promoter (Effigy 5C).

3.6. A mineralocorticoid responsive element (MRE) in the ICAM-1 promoter is necessary for MR-dependent transcriptional regulation

To identify putative binding sites for transcription factors that may be involved in modulation of ICAM-1 gene expression induced past ALDO, we performed bioinformatic analysis (database on jasper.genereg.net) of the promoter region betwixt nucleotides −1141 and −872. The analysis showed the presence of putative binding sites for MR, NF-κB and AP-i (Figure 6A). In order to determine if the MRE mediates ALDO responsiveness of the 1141 bp ICAM-1 promoter fragment, we first generated an 1141bp promoter fragment lacking the putative MRE. Transcriptional analysis showed that the absence of the MRE completely blocked the ALDO-induced promoter action (Effigy 6B). The promoter action in the absenteeism of MRE was comparable to that of the 872bp construct. We besides examined the involvement of NF-κB and c-Jun (a component of the AP-one transcription factor) by analyzing ALDO responsiveness of the 1141 bp promoter after adenovirus infection with dominant negative constructs for c-Jun (Advertizement-dn-c-Jun) or for NF-κB (Ad-dn-IκBα). A viral construct expressing Ad-GFP was used as control. Interestingly, cells infected with Advertisement-dn-c-Jun and Ad-dn- IκBα (50 MOI) displayed blunted 1141bp ICAM-1 promoter activeness, induced by ALDO, compared to command infection with Advertizement-GPF (Effigy 6C), suggesting that c-Jun and NF-κB may contribute in role to the regulation of ICAM-i promoter activity by MR in man ECs.

A predicted mineralocorticoid receptor responsive element in the ICAM-ane promoter is necessary for MR-induced transcriptional activity

A) Schematic representation of putative binding sites for known transcription factors determined by bioinformatic analysis of ICAM-ane promoter region between 1141 bp and 872 bp. B) Human being umbilical vein endothelial cells (HUVEC) were transfected with luciferase reporter constructs containing the intact 1141Kb promoter of human ICAM-1 gene and with the predicted MR responsive element (MRE) deleted. Transfected HUVECs were treated with vehicle, aldosterone (ALDO ten⁻⁸Grand) or ALDO + spironolactone (SPIRO; ten⁻⁵Thousand). Luciferase activity was expressed as fold increase compared to Vehicle. ***=p<0.001 versus Vehicle and ###=p<0.001 vs ICAM1141 + ALDO. C) Promoter activity of the 1141bp ICAM-ane promoter fragment afterward infection with ascendant negative (dn) constructs. Later infection with Ad-GFP, Advertizing-dn-c-Jun and Ad-dn-IκBα, HUVECs were transfected with ICAM1141 promoter fragment and treated with vehicle or ALDO (x⁻⁸M). The luciferase activity was expressed as fold increase compared to Vehicle Ad-GFP. ***=p<0.001 versus Vehicle Advertizing-GFP. North = 3 independent experiments.

four. Discussion

This report reveals a fundamental role for ICAM-1 in ALDO induction of early atherosclerosis and supports a novel mechanism by which claret pressure level–independent effects of ALDO promote early development of vascular inflammation and atherosclerotic plaque germination. Specifically, nosotros demonstrated for the first time in vivo that ALDO enhances vascular ICAM-one expression in the aorta of ApoE^−/− mice and that ICAM-1 is necessary for ALDO to increase aortic root plaque size and lipid and inflammatory cell content independent of blood pressure. In add-on, we show that ALDO regulates ICAM-1 expression in human ECs by activating EC MR and enhancing ICAM-1 transcription via a MRE in the human ICAM-1 proximal promoter.

A robust trunk of evidence demonstrates that plasma levels of ALDO represent an independent predictor of cardiovascular ischemia [5]. In fact, it has been shown that higher ALDO levels, even within the normal range, predict a significant increase in myocardial infarction and cardiovascular death, in patients with atherosclerosis [2]. A recent written report on the general population reported that ALDO levels were associated with hypertension, visceral obesity, metabolic syndrome, high triglycerides, concentric left ventricular hypertrophy, and increased bloodshed. Importantly, this association persisted even after adjustment for torso mass index and later on excluding subjects with ALDO levels in a higher place the normal range [32]. Thus, ALDO levels are elevated in growing populations at loftier adventure for cardiovascular ischemic events and, even in the general population, predicts poor cardiovascular outcomes past mechanisms that are not totally clear.

In the present study nosotros used a dose of ALDO that produced a modest, but clinically relevant, increment in serum ALDO, to mimic ALDO plasma level of patients with cardiovascular diseases [17], and then characterized atherosclerotic plaque burden in ApoE^−/−/ICAM-1^+/+ and ApoE^−/−/ICAM-1^−/− mice treated for 4 weeks and fed a HFD. Chiefly, ALDO treatment at this dose did not increase systolic blood force per unit area, nor did it alter metabolic parameters known to affect cardiovascular run a risk (body weight, total cholesterol, glucose, Table1), excluding misreckoning hemodynamic and metabolic factors that could have altered the atherosclerotic process. This suggests a direct effect of ALDO on the vasculature that nosotros propose may exist mediated past activation of MR in the endothelium to up-regulate ICAM-1. This is consistent with our information showing that this dose of ALDO significantly increased ICAM-ane transcript levels in whole aorta independent of changes in blood pressure level.

Moreover, we showed for the showtime time that ApoE^−/−/ICAM-1^−/− mice are resistant to develop early atherosclerosis induced by ALDO treatment for 4 weeks. Mayhap more importantly, the ALDO-induced increment in plaque lipid and inflammatory jail cell content was also prevented in mice lacking ICAM-ane. This has important clinical implications since a plaque phenotype with increased lipids and inflammatory cells is known to contribute to susceptibility to rupture, the cause of nigh MIs and strokes [sixteen]. This mechanism may therefore explain the increased risk of MI and stroke in patients with elevated ALDO levels [2,4].

Since ICAM-1 is a known mediator of atherogenesis, information technology may seem surprising that we found no difference in the plaque burden in the vehicle treated animals lacking ICAM-1. This apparent discrepancy is probable explained past the early time frame with merely iv weeks of treatment with high fat nutrition. This is consistent with a previous paper by Bourdillon et al. which investigated the furnishings of the lack of the ICAM-1 cistron on atherosclerosis development in ApoE−/− mice [28]. In this work, the authors analyzed the atherosclerotic plaque size in the aortic arch region of ApoE^−/−/ICAM-1^−/− (DKO) and ApoE^−/−/ICAM-1^+/+ (KO) mice fed grub or HFD for 3, 6, xv, 20 weeks. DKO and KO mice fed HFD for 6 weeks showed comparable atherosclerosis, indicating that the lack of ICAM-1 cistron does non touch on plaque burden at this early time. On the other hand, Bourdillon et al. find that, after a longer treatment with HFD, DKO mice displayed reduced atherosclerosis compared with KO mice, indicating that the atherosclerotic brunt observed later on fifteen weeks of HFD is affected by the presence of ICAM-ane. Overall, the information supports that ALDO promotes early on plaque evolution and inflammation by upregulation of ICAM-1 and that even in the absence of exogenous ALDO, ICAM-one farther contributes to belatedly plaque burden.

In the vasculature, ECs limited several adhesion molecules, including ICAM-1, involved in early steps of atherosclerosis. Whether the EC-MR-ICAM1 pathway plays an important role in inflammation in vivo has been controversial [33]. A mouse defective MR in ECs and leukocytes developed less inflammation and macrophage recruitment into cardiac tissue in response to mineralocorticoid-induced hypertension [34]. Another study showed that ALDO treatment increases ICAM-1 in rat centre, leading to inflammatory arterial lesions [35]. While these studies suggested a part for EC-MR regulation of ICAM in cardiac inflammation, in some other study examining cardiac inflammation in response to pressure overload induced past trans-aortic constriction, ICAM-1 levels in the heart increase and contribute to cardiac inflammation but this was not affected by specific deletion of MR just from ECs [36]. The current written report is the outset to evaluate the office of ICAM-1 regulation by MR in atherosclerosis and vascular inflammation in vivo.

Since EC adhesion molecules contribute to vascular inflammation and atherosclerosis in beast models and humans, studies have examined whether these proteins could be biomarkers to predict ischemic events. Some studies accept shown an clan between serum levels of adhesion molecules and plaque stability. For example, Hoke et al. identified soluble ICAM-1 and VCAM-1 as predictors of cardiovascular events in patients with stable carotid atherosclerosis [37]. However, the prognostic significance of soluble ICAM-i (sICAM-1) in the cardiovascular diseases is even so controversial with some studies showing patients with higher circulating levels of sICAM-ane having increased number of cardiovascular events [38,39] and others finding no relationship between sICAM-ane and the risk of cardiovascular events [40]. Thus further studies are needed to determine if circulating adhesion molecules will be a clinically valuable biomarker of gamble or perhaps serum aldosterone levels may be more predictive.

In add-on to transcriptional regulation, MR is known to attune the expression of target genes through rapid non-genomic activation of protein kinases and secondary messenger signaling pathways [41]. To clarify the mechanisms by which endothelial MR regulates ICAM-1, we explored the time grade of the increase in EC ICAM-1 surface poly peptide expression in response to ALDO. Nosotros confirmed that 24-hours of ALDO treatment increased transcript levels of ICAM-i and that SPIRO prevented such consequence, consequent with prior studies [27,34]. Increased surface protein expression of ICAM-1 was detected later 24 hours of ALDO treatment simply non after 30 minutes to three hours, excluding the involvement of rapid non-genomic effects of ALDO in the control of ICAM-one surface poly peptide expression.

To appointment, despite the large body of prove that links MR activation with pro-inflammatory phenotype [17,42], only few studies have investigated the molecular machinery past which MR directly interacts with pro-inflammatory factor promoters. In vascular shine musculus and mesangial cells, it has been observed that ALDO is able to actuate NF-κB and AP-i (heterodymer of c-Jun/c-Fos) to induce inflammatory responses [43,44], but the molecular machinery through which ALDO induces ICAM-1 transcription in human ECs has not previously been elucidated. In cultured mesangial cells, it was shown that ALDO stimulates ICAM-one gene expression through Serum-Glucocorticoid Regulated Kinase i/NF-κB signaling [45]. Conversely, in neutrophil jail cell cultures, ALDO decreases ICAM-1 expression by inhibiting NF-κB pathway [46]. These studies point that inflammatory pathways downstream MR may vary depending on the jail cell blazon and surroundings. Therefore we sought to investigate mechanisms controlling ICAM-1 transcription in response to ALDO in human ECs. Our analysis of the human ICAM-1 promoter identified a novel MRE and two closely side by side binding sites for NF-κB and AP-1. We demonstrated that specific deletion of MRE in human ICAM-1 promoter leads to complete inhibition of promoter activity induced by ALDO, indicating this MRE every bit essential for MR-induced ICAM-ane cistron expression. Inability of several MR antibodies that we tested to immunoprecipitate MR in HUVECs or HEK293T (homo embryonic kidney, expressing loftier level of MR) cell lines, did non allow us to perform chromatin immunoprecipitation analysis to demonstrate direct binding of MR to the endogenous ICAM-1 promoter region, and this represents a limitation of our report.

Using adenovirus expressing dominant negative for c-Jun and NF-kB, nosotros also observed that inhibition of each of these two transcription factors does not completely abolish MR-induced ICAM-1 transcription but rather partially adulterate the result of ALDO. These data suggest a mechanism in which NF-kB and AP1 play a permissive role in MR-mediated regulation of ICAM-1 transcription that requires the MRE. This suggests that in ECs, ALDO regulates ICAM-one transcription by a mechanism that differs from that in mesangial cells [45].

Several additional limitations of our study should exist pointed out. First, all studies were performed in male person mice. Equally the incidence and outcomes from atherosclerotic vascular disease differ in males and females, and studies bear witness that estrogen receptor may attune MR regulation of ICAM-1 in endothelial cells [47], future studies are needed to explore whether this mechanism contributes to plaque formation in females. Another limitation stems from the lack of investigation of macrophages ICAM-1 expression in response to ALDO, which could likewise contribute to explicate the pro-atherogenic effects of ALDO [48]. In fact, MR is expressed in macrophages and affects their M1/M2 polarization and cardiac infiltration [49–51]. Notably, monocytes undergo macrophage activation in atherosclerotic lesions and contribute differently to the evolution of the plaque [52]. We did not quantify the smooth muscle jail cell component of the plaques since contempo studies suggest that traditional polish muscle cell markers are down-regulated in plaque SMCs thereby preventing accurate quantification of SMC without lineage tracing [53]. Finally, nosotros did not measure HDL and LDL levels in serum samples, since the book of serum obtained from mice was not enough to include these measurements.

Despite these limitations, our study broadens the possibility of therapeutic utilize of MR antagonists in different clinical settings, well across primary aldosteronism and resistant hypertension [54]. Since nosotros show the critical relevance of endothelial MR activation past ALDO in the consecration of ICAM-1 expression, vascular inflammation, and formation of vulnerable atherosclerotic plaques, this may exist relevant in new populations of patients. Pharmacological blockade of the MR could be considered to preclude adverse cardiovascular outcomes in patients with obesity, metabolic syndrome, or known atherosclerotic vascular affliction, where the risk of myocardial infarction or stroke is increased and independently associated with plasma ALDO levels. In this context, it is important to remark that the electric current normal values for ALDO do not accept into account sensitivity of the endothelium to ALDO at levels that practice non increment blood pressure level and that the adverse cardiovascular effects of ALDO occur when plasma levels are inappropriate for salt status [55]. Finally, this study identifies transcriptional up-regulation of ICAM-1 by endothelial MR as a novel machinery that may contribute to the association of ALDO with risk of cardiovascular ischemia and highlights the clinical relevance of pharmacological MR antagonism to preclude atherosclerosis in patients with high cardiovascular risk.

Supplementary Textile

i

Supplemental Fig. 1. Aortic apoptosis regulatory proteins are not altered past ALDO infusion or ICAM-1 cistron expression:

Aortic root was harvested from Aldosterone (ALDO)- or vehicle-infused ApoE−/−/ICAM-1+/+ or ApoE−/−/ICAM-i−/− mice fed an atherogenic diet for 4 weeks (Due north=6 mice per genotype and treatment). Western blot was performed to find PARP or BCL-X expression in aortic root poly peptide lysates. A) Representative immunoblot for PARP and BCL-X. β-actin was used as loading command. B–D) Densitometric scanning analyses for PARP-short (broken)/PARP-long (total length) ratio (B), BCLX-long (C) and BCLX-curt (D) performed past Mac OS X (NIH Paradigm 1.62 software). Values are expressed as ways ± SEM.

2

Supplemental Fig. 2. Neither ALDO infusion nor deletion of ICAM-1 gene alters aortic TGF-β1 transcript levels:

ApoE−/−/ICAM-1+/+ or ApoE−/−/ICAM-1−/− mice were treated with Aldosterone (ALDO) or vehicle and were fed an atherogenic diet for 4 weeks. The aortic root was harvested (N=6 mice per genotype and treatment) and TGF-β1 mRNA was quantified past RT-PCR. Values are expressed as means ± SEM.

Acknowledgments

The authors wish to give thanks Mark Aronovitz and Carol Galayda for technical teaching and assist to A.A. for atherosclerosis studies, Andrea Marcello Isidori and Mary Anna Venneri for tail gage analysis of blood force per unit area. We also give thanks Claudio Sette for fruitful give-and-take and scientific support. We would like to admit networking support past the COST Action ADMIRE BM1301. This work was supported by a grant from Ministero della Salute (BANDO 2011–2012 Progetti Collaborazione Ricercatori Italiani all'Estero; project grant PE-2011-02347070 to G.C.) and by a grant from the National Institutes of Health (({"blazon":"entrez-nucleotide","attrs":{"text":"HL095590","term_id":"1051665999","term_text":"HL095590"}}HL095590) to IZJ).

Nonstandard Abbreviations and Acronyms

ALDO	aldosterone
MI	myocardial infarction
MR	mineralocorticoid receptor
EC	endothelial prison cell
ICAM-1	intercellular adhesion molecule 1
VCAM-1	vascular cell adhesion molecule one
ApoE	apolipoprotein E
HFD	high fat nutrition
SPIRO	spironolactone
MRE	mineralocorticoid responsive element
NF-κB	nuclear gene kappa-calorie-free-chain-enhancer of activated B cells
AP-one	activator protein i
HUVEC	human being umbilical vein endothelial cell
TGFβ	Transforming growth factor β

Footnotes

Publisher'southward Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers nosotros are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final citable course. Delight note that during the product process errors may be discovered which could affect the content, and all legal disclaimers that utilise to the journal pertain.

Conflict of interests

The authors report no relationships that could be construed every bit a conflict of interest.

References

one. Beygui F, Collet JP, Benoliel JJ, et al. High plasma aldosterone levels on admission are associated with decease in patients presenting with acute ST-elevation myocardial infarction. Circulation. 2006;114:2604–2610. [PubMed] [Google Scholar]

2. Ivanes F, Susen Southward, Mouquet F, et al. Aldosterone, bloodshed, and astute ischaemic events in coronary artery disease patients exterior the setting of acute myocardial infarction or heart failure. Eur. Heart J. 2012;33:191–202. [PubMed] [Google Scholar]

iii. Tomaschitz A, Pilz Southward, Ritz E, et al. Association of plasma aldosterone with cardiovascular mortality in patients with low estimated GFR: the Ludwigshafen Risk and Cardiovascular Health (LURIC) Study. Am. J. Kidney Dis. 2011;57:403–414. [PubMed] [Google Scholar]

4. Milliez P, Girerd X, Plouin PF, et al. Evidence for an increased rate of cardiovascular events in patients with chief aldosteronism. J. Am. Coll. Cardiol. 2005;45:1243–1248. [PubMed] [Google Scholar]

five. de Rita O, Hackam DG, Spence JD. Effects of aldosterone on human atherosclerosis: plasma aldosterone and progression of carotid plaque. Tin. J. Cardiol. 2012;28:706–711. [PubMed] [Google Scholar]

vi. Bentley-Lewis R, Adler GK, Perlstein T, et al. Body mass index predicts aldosterone product in normotensive adults on a loftier-salt diet. J. Clin. Endocrinol. Metab. 2007;92:4472–4475. [PMC free article] [PubMed] [Google Scholar]

7. Laffin LJ, Majewski C, Liao C, et al. Relationship Betwixt Obesity, Hypertension, and Aldosterone Production in Postmenopausal African American Women: A Airplane pilot Study. J. Clin. Hypertens. (Greenwich.) 2016 [PMC free article] [PubMed] [Google Scholar]

viii. Calhoun DA. Aldosteronism and hypertension. Clin. J. Am. Soc. Nephrol. 2006;ane:1039–1045. [PubMed] [Google Scholar]

9. Bansal Southward, Lindenfeld J, Schrier RW. Sodium retention in heart failure and cirrhosis: potential role of natriuretic doses of mineralocorticoid antagonist? Circ. Heart Neglect. 2009;2:370–376. [PubMed] [Google Scholar]

10. Pitt B, Zannad F, Remme WJ, et al. The outcome of spironolactone on morbidity and bloodshed in patients with severe heart failure. Randomized Aldactone Evaluation Study Investigators. N. Engl. J. Med. 1999;341:709–717. [PubMed] [Google Scholar]

eleven. Pitt B, Remme W, Zannad F, et al. Eplerenone, a selective aldosterone blocker, in patients with left ventricular dysfunction afterward myocardial infarction. N. Engl. J. Med. 2003;348:1309–1321. [PubMed] [Google Scholar]

12. Davignon J, Ganz P. Part of endothelial dysfunction in atherosclerosis. Circulation. 2004;109:III27–III32. [PubMed] [Google Scholar]

13. Hansson GK, Hermansson A. The immune system in atherosclerosis. Nat. Immunol. 2011;12:204–212. [PubMed] [Google Scholar]

14. Poston RN, Haskard Practise, Coucher JR, et al. Expression of intercellular adhesion molecule-i in atherosclerotic plaques. Am. J. Pathol. 1992;140:665–673. [PMC free article] [PubMed] [Google Scholar]

15. Iiyama Thou, Hajra L, Iiyama Grand, et al. Patterns of vascular jail cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circ. Res. 1999;85:199–207. [PubMed] [Google Scholar]

sixteen. Moss ME, Jaffe IZ. Mineralocorticoid Receptors in the Pathophysiology of Vascular Inflammation and Atherosclerosis. Front Endocrinol. (Lausanne) 2015;6:153. [PMC free article] [PubMed] [Google Scholar]

17. McGraw AP, Bagley J, Chen WS, et al. Aldosterone increases early on atherosclerosis and promotes plaque inflammation through a placental growth gene-dependent machinery. J. Am. Heart Assoc. 2013;ii:e000018. [PMC complimentary article] [PubMed] [Google Scholar]

18. Keidar S, Kaplan M, Pavlotzky E, et al. Aldosterone assistants to mice stimulates macrophage NADPH oxidase and increases atherosclerosis evolution: a possible role for angiotensin-converting enzyme and the receptors for angiotensin II and aldosterone. Circulation. 2004;109:2213–2220. [PubMed] [Google Scholar]

19. Bodary PF, Sambaziotis C, Wickenheiser KJ, et al. Aldosterone promotes thrombosis formation after arterial injury in mice. Arterioscler. Thromb. Vasc. Biol. 2006;26:233. [PubMed] [Google Scholar]

20. Keidar S, Hayek T, Kaplan Chiliad, et al. Effect of eplerenone, a selective aldosterone blocker, on blood pressure, serum and macrophage oxidative stress, and atherosclerosis in apolipoprotein E-scarce mice. J. Cardiovasc. Pharmacol. 2003;41:955–963. [PubMed] [Google Scholar]

21. Raz-Pasteur A, Gamliel-Lazarovich A, Coleman R, et al. Eplerenone reduced lesion size in early merely not advanced atherosclerosis in apolipoprotein East-deficient mice. J. Cardiovasc. Pharmacol. 2012;60:508–512. [PubMed] [Google Scholar]

22. Raz-Pasteur A, Gamliel-Lazarovich A, Gantman A, et al. Mineralocorticoid receptor occludent inhibits accelerated atherosclerosis induced by a low sodium diet in apolipoprotein Eastward-deficient mice. J. Renin. Angiotensin. Aldosterone. Syst. 2014;15:228–235. [PubMed] [Google Scholar]

23. Huby Air conditioning, Antonova G, Groenendyk J, et al. Adipocyte-Derived Hormone Leptin Is a Direct Regulator of Aldosterone Secretion, Which Promotes Endothelial Dysfunction and Cardiac Fibrosis. Apportionment. 2015;132:2134–2145. [PubMed] [Google Scholar]

24. Schafer Northward, Lohmann C, Winnik S, et al. Endothelial mineralocorticoid receptor activation mediates endothelial dysfunction in nutrition-induced obesity. Eur. Eye J. 2013;34:3515–3524. [PMC free commodity] [PubMed] [Google Scholar]

25. Jia G, Habibi J, Aroor AR, et al. Endothelial Mineralocorticoid Receptor Mediates Nutrition-Induced Aortic Stiffness in Females. Circ. Res. 2016;118:935–943. [PMC free article] [PubMed] [Google Scholar]

26. Mueller KB, Bough SB, Hong K, et al. Endothelial Mineralocorticoid Receptors Differentially Contribute to Coronary and Mesenteric Vascular Office Without Modulating Blood Force per unit area. Hypertension. 2015;66:988–997. [PMC free article] [PubMed] [Google Scholar]

27. Caprio M, Newfell BG, la SA, et al. Functional mineralocorticoid receptors in human being vascular endothelial cells regulate intercellular adhesion molecule-1 expression and promote leukocyte adhesion. Circ. Res. 2008;102:1359–1367. [PMC free commodity] [PubMed] [Google Scholar]

28. Bourdillon MC, Poston RN, Covacho C, et al. ICAM-i deficiency reduces atherosclerotic lesions in double-knockout mice (ApoE(−/−)/ICAM-one(−/−)) fed a fat or a chow diet. Arterioscler. Thromb. Vasc. Biol. 2000;20:2630–2635. [PubMed] [Google Scholar]

29. Jaffe IZ, Newfell BG, Aronovitz K, et al. Placental growth factor mediates aldosterone-dependent vascular injury in mice. J. Clin. Invest. 2010;120:3891–3900. [PMC free article] [PubMed] [Google Scholar]

30. Schmidt BM, Sammer U, Fleischmann I, et al. Rapid nongenomic effects of aldosterone on the renal vasculature in humans. Hypertension. 2006;47:650–655. [PubMed] [Google Scholar]

31. Losel R, Schultz A, Boldyreff B, et al. Rapid effects of aldosterone on vascular cells: clinical implications. Steroids. 2004;69:575–578. [PubMed] [Google Scholar]

32. Buglioni A, Cannone V, Cataliotti A, et al. Circulating aldosterone and natriuretic peptides in the general customs: relationship to cardiorenal and metabolic affliction. Hypertension. 2015;65:45–53. [PMC gratuitous article] [PubMed] [Google Scholar]

33. Caprio M, Mammi C, Jaffe IZ, et al. The mineralocorticoid receptor in endothelial physiology and disease: novel concepts in the understanding of erectile dysfunction. Curr. Pharm. Des. 2008;fourteen:3749–3757. [PubMed] [Google Scholar]

34. Rickard AJ, Morgan J, Chrissobolis S, et al. Endothelial prison cell mineralocorticoid receptors regulate deoxycorticosterone/salt-mediated cardiac remodeling and vascular reactivity but not blood force per unit area. Hypertension. 2014;63:1033–1040. [PubMed] [Google Scholar]

35. Rocha R, Rudolph AE, Frierdich GE, et al. Aldosterone induces a vascular inflammatory phenotype in the rat centre. Am. J. Physiol Center Circ. Physiol. 2002;283:H1802–H1810. [PubMed] [Google Scholar]

36. Salvador M, Nevers T, Velázquez F, et al. Intercellular Adhesion Molecule 1 Regulates Left Ventricular Leukocyte Infiltration, Cardiac Remodeling, and Office in Pressure Overload-Induced Heart Failure. J. Am. Centre Assoc. 2016;5:e003126. [PMC gratis article] [PubMed] [Google Scholar]

37. Hoke M, Winter MP, Wagner O, et al. The impact of selectins on mortality in stable carotid atherosclerosis. Thromb. Haemost. 2015;114:632–638. [PubMed] [Google Scholar]

38. Hwang SJ, Ballantyne CM, Sharrett AR, et al. Circulating adhesion molecules VCAM-1, ICAM-1, and E-selectin in carotid atherosclerosis and incident coronary heart affliction cases: the Atherosclerosis Risk In Communities (ARIC) study. Circulation. 1997;96:4219–4225. [PubMed] [Google Scholar]

39. Bonaterra GA, Zugel S, Kinscherf R. Novel systemic cardiovascular illness biomarkers. Curr. Mol. Med. 2010;10:180–205. [PubMed] [Google Scholar]

40. Postadzhiyan AS, Tzontcheva AV, Kehayov I, et al. Circulating soluble adhesion molecules ICAM-ane and VCAM-one and their association with clinical outcome, troponin T and C-reactive protein in patients with acute coronary syndromes. Clin. Biochem. 2008;41:126–133. [PubMed] [Google Scholar]

41. Dooley R, Harvey BJ, Thomas Due west. Non-genomic deportment of aldosterone: from receptors and signals to membrane targets. Mol. Cell Endocrinol. 2012;350:223–234. [PubMed] [Google Scholar]

42. Krug AW, Allenhofer L, Monticone R, et al. Elevated mineralocorticoid receptor activity in aged rat vascular smooth musculus cells promotes a proinflammatory phenotype via extracellular bespeak-regulated kinase 1/two mitogen-activated protein kinase and epidermal growth cistron receptor-dependent pathways. Hypertension. 2010;55:1476–1483. [PMC free article] [PubMed] [Google Scholar]

43. Zhu CJ, Wang QQ, Zhou JL, et al. The mineralocorticoid receptor-p38MAPK-NFkappaB or ERK-Sp1 signal pathways mediate aldosterone-stimulated inflammatory and profibrotic responses in rat vascular smooth muscle cells. Acta Pharmacol. Sin. 2012;33:873–878. [PMC gratis article] [PubMed] [Google Scholar]

44. Han JS, Choi BS, Yang CW, et al. Aldosterone-induced TGF-beta1 expression is regulated by mitogen-activated protein kinases and activator poly peptide-1 in mesangial cells. J. Korean Med. Sci. 2009;24(Suppl):S195–S203. [PMC free article] [PubMed] [Google Scholar]

45. Terada Y, Ueda S, Hamada K, et al. Aldosterone stimulates nuclear factor-kappa B activity and transcription of intercellular adhesion molecule-1 and connective tissue growth cistron in rat mesangial cells via serum- and glucocorticoid-inducible protein kinase-1. Clin. Exp. Nephrol. 2012;xvi:81–88. [PubMed] [Google Scholar]

46. Bergmann A, Eulenberg C, Wellner G, et al. Aldosterone abrogates nuclear gene kappaB-mediated tumor necrosis factor alpha production in homo neutrophils via the mineralocorticoid receptor. Hypertension. 2010;55:370–379. [PubMed] [Google Scholar]

47. Barrett MK, Lu Q, Mohammad NN, et al. Estrogen receptor inhibits mineralocorticoid receptor transcriptional regulatory function. Endocrinology. 2014;155:4461–4472. [PMC free article] [PubMed] [Google Scholar]

48. Yang M, Liu J, Piao C, et al. ICAM-1 suppresses tumor metastasis by inhibiting macrophage M2 polarization through blockade of efferocytosis. Cell Death. Dis. 2015;6:e1780. [PMC gratuitous article] [PubMed] [Google Scholar]

49. Usher MG, Duan SZ, Ivaschenko CY, et al. Myeloid mineralocorticoid receptor controls macrophage polarization and cardiovascular hypertrophy and remodeling in mice. J. Clin. Invest. 2010;120:3350–3364. [PMC free article] [PubMed] [Google Scholar]

fifty. Bienvenu LA, Morgan J, Rickard AJ, et al. Macrophage mineralocorticoid receptor signaling plays a key role in aldosterone-independent cardiac fibrosis. Endocrinology. 2012;153:3416–3425. [PubMed] [Google Scholar]

51. Bene NC, Alcaide P, Wortis HH, et al. Mineralocorticoid receptors in immune cells: emerging part in cardiovascular disease. Steroids. 2014;91:38–45. [PMC gratis commodity] [PubMed] [Google Scholar]

52. Mantovani A, Garlanda C, Locati M. Macrophage diversity and polarization in atherosclerosis: a question of balance. Arterioscler. Thromb. Vasc. Biol. 2009;29:1419–1423. [PubMed] [Google Scholar]

53. Shankman LS, Gomez D, Cherepanova OA, et al. KLF4-dependent phenotypic modulation of smooth musculus cells has a key role in atherosclerotic plaque pathogenesis. Nat. Med. 2015;21:628–637. [PMC free article] [PubMed] [Google Scholar]

54. Clark D, Iii, Ahmed MI, Calhoun DA. Resistant hypertension and aldosterone: an update. Tin. J. Cardiol. 2012;28:318–325. [PubMed] [Google Scholar]

55. Funder JW. Sensitivity to aldosterone: plasma levels are not the full story. Hypertension. 2014;63:1168–1170. [PubMed] [Google Scholar]

grishamjudy1997.blogspot.com

Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5890338/

Share this post